About 1,222,541 results (2,465 milliseconds)
US20100290964A1 - HIGH Pd CONTENT DIESEL OXIDATION ...
https://patents.google.com/patent/US20100290964A1/en 16A and B show the SGB testing/oven aging data for a conventional DOC, 150 @ 4:1 vs 'quench' resistant DOC, 210 gcf PGM @ 1:1.1 using C3 only HC mix. [0049].
WO2021178720A2 - Methods and compositions for modulating a ...
https://patents.google.com/patent/WO2021178720A2/en 210. A system comprising a first lipid nanoparticle comprising the ... 160, 150-160, 100-150, 110-150, 120-150, 130-150, 140-150, 100-140, 110-140 ...
CN113727603A - Methods and compositions for inserting antibody ...
https://patents.google.com/patent/CN113727603A/en ... 150, at least about 200, at least about 250, at least about 300, at least ... <210> 120. <211> 2238. <212> DNA. <213> Artificial Sequence (Artificial ...
SpeechClassification30ClassesusingCNN2.ipynb - Colab
https://colab.research.google.com/github/cclarke411/Deep-Learning-Experiments/blob/master/SpeechClassification30ClassesusingCNN2.ipynb ... 120 28 0.05 0.07 0.06 115 29 0.09 0.06 0.07 260 accuracy 0.08 5450 macro avg ... gcf() #fig.set_size_inches(cm2inch(40, 20)) #fig.set_size_inches ...
US11304688B2 - Gastrocutaneous closure device - Google Patents
https://patents.google.com/patent/US11304688B2/en?q=(GASTROCUTANEOUS+CLOSURE+DEVICE)&oq=GASTROCUTANEOUS+CLOSURE+DEVICE ... 210 resulting from a gastrostomy tube removal. The sleeve 142 has a ... The linkage 130 secures the central hub 120 to the appendage 150 against a ...
US20130181527A1 - Systems and methods for solar photovoltaic ...
https://patents.google.com/patent/US20130181527A1/pt-PT the amplitude scaling factor can be based on the grid signal 810 and averaged at a particular frequency (e.g., at 60 Hz or 120 Hz). The signal can then be ...
Java client library | Google Cloud
https://cloud.google.com/java/docs/reference/google-cloud-storage/latest/history update conformance test dep (#210) (010c112); update core dependencies (#182) ... add IAM Conditions support (#120) (8256f6d); examples of creating a ...
AU2022280063A1 - Chimeric antigen receptor to target hla-g ...
https://patents.google.com/patent/AU2022280063A1/en Jan 4, 2024 ... ... 150, 1-151, 1-152, 1-153, 1-154, 1-. 155, 1-156, 1-157, 1-158, 1-159 ... 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450 ...
all-countries.ipynb - Colab
https://colab.research.google.com/github/dkobak/excess-mortality/blob/main/all-countries.ipynb ... 150 -50 ± 90 0.6 --- -60 -9% Argentina Dec 31, 2022 m 130,000 190,000 ... 210 26% Chile Dec 31, 2023 w 63,000 66,000 ± 4,400 15.1 1.0 340 58% Colombia ...
US9531293B2 - Systems and methods for solar photovoltaic energy ...
https://patents.google.com/patent/US9531293B2/en According to an embodiment, the amplitude scaling factor can be based on the grid signal 810 and averaged at a particular frequency (e.g., at 60 Hz or 120 Hz).
KR20230169989A - Systems and methods for protein expression ...
https://patents.google.com/patent/KR20230169989A/en Dec 18, 2023 ... ... GCF), bone morphogenetic protein-2 (BMP-2), bone morphogenetic protein-7 (BMP-7) ... 기타사항: 서열번호 120Other information: SEQ ID NO: 120.
Untitled
https://groups.google.com/group/suryamech2010/attach/6d564320d0fdfab7/placementpapers_2013_IBM.doc?part=0.9 (c) 120 (Ans). (d) 150. Ans : The pattern is x 2, x 3, x 4 ... ∴ Missing number = 37 x 2 + 1 = 75. 33. 24, 60, 120, 210, (...) (a) 300. (b) ...
AU2020200116B2 - Chlorotoxin conjugates and methods of use ...
https://patents.google.com/patent/AU2020200116B2/en <210> 120 <211> 43 <212> PRT <213> Artificial Sequence <220> <223> ... <210> 150 <211> 36 <212> PRT <213> Artificial Sequence <220> <223> Description of ...
WO2021240488A1 - Compositions and methods for treating ...
https://patents.google.com/patent/WO2021240488A1/en ... 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260 ... AIBP mRNA was mainly expressed in photoreceptors (RIS, ONE & OPF) and inner neurons ...
[Info-Ingres] Application hangs
https://groups.google.com/g/fa.ingres/c/fUMOnSJ0viM ii.localhost.dbms.private.*.p32k.dmf_group_count: 150 ii.localhost.dbms ... ii.localhost.gcf.mech.ingres.expiration_time: 120 ii.localhost.gcf.mech ...
CA2354232A1 - Compounds and methods for treatment and ...
https://patents.google.com/patent/CA2354232A1/en ... <210> 120 <211> 897 <212> DNA <213> Chlamydi.a <400> atggcttctatatgcggacgt ... 7 <210> 150 <211> 1C~ <212> PkT <213> Artificial :~c.-:quence <220> <223> ...
AU714695B2 - Methods and compositions for inhibition of ...
https://patents.google.com/patent/AU714695B2/en ... 120 162-204 40-14 432A6 566- 00 $02-550 566a600 T19-553 569-60) 144-199 206 ... 210 i WOODCHUCK IREPATITIS VIRUS I AFRICAN SWrIE FEVER VIRUS_ HUMIAN ...
KR20220165645A - Atranorin biosynthesis gene derived from ...
https://patents.google.com/patent/KR20220165645A/en GCF of the PKS17 family, shared by C. borealis , C. macilenta and C ... <120> Atranorin biosynthesis gene derived from lichens and uses thereof <130> PA ...
EP2990057B1 - Pai-1 inhibitor for use in enhancing the antitumor ...
https://patents.google.com/patent/EP2990057B1/en ... GCF(V+Ab) group, and compound c+anti-GCF (Com-c +Ab) group. Fig. 18 shows ... 120% or higher, more preferably 150% or higher, and most preferably 200 ...
HU229680B1 - Methods for protecting allogeneic islet transplant ...
https://patents.google.com/patent/HU229680B1/en Other non-CTLA4 moieties for use in soluble CTLA4 molecules or soluble CTLA4 mutant molecules include, but are not limited to, the p97 molecule, env gp120 ...